Display Settings:

Format

Send to:

Choose Destination
Pr012381458

STS probe D3S2953E for uncharacterized LOC100430346 (LOC100430346)

Synopsis

Field NameValues
NameD3S2953E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100430346
UniSTS IDUniSTS:150937

Sequences

>Probe|12381458|PRIMERF Forward PCR primer (outermost) (20b)
TCTCCCTTTCTGGTCTCCTC
>Probe|12381458|PRIMERR Reverse PCR primer (outermost) (21b)
GCCCTGTTTGTATGGTAGTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S2953E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID150937
Probe Cross-refcontext specific help for: Probe Cross-refGDB:442245
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center