Display Settings:

Format

Send to:

Choose Destination
Pr012381154

STS probe D2S1579E for protein activator of interferon induced protein kinase EIF2AK2 (PRKRA) and 15 more genes

Synopsis

Field NameValues
NameD2S1579E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100134206; LOC100289695; LOC100294210; PRKRA; PRKRA; LOC100506831; LOC100507716; LOC100509607; LOC100510280; PRKRA; PRKRA; PRKRA; LOC709385; PRKRAP1More
UniSTS IDUniSTS:150663

Sequences

>Probe|12381154|PRIMERF Forward PCR primer (outermost) (22b)
CTGCATCACTTTGTGCATTGCC
>Probe|12381154|PRIMERR Reverse PCR primer (outermost) (22b)
ATGTTTTGCTGAACTGTCCACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S1579E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID150663
Probe Cross-refcontext specific help for: Probe Cross-refGDB:440571
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center