Display Settings:

Format

Send to:

Choose Destination
Pr012380402

STS probe DXS6680 for proline rich and Gla domain 1 (PRRG1) and 1 more gene

Synopsis

Field NameValues
NameDXS6680
AliasDXS6680.1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRRG1; PRRG1
UniSTS IDUniSTS:149986

Sequences

>Probe|12380402|PRIMERF Forward PCR primer (outermost) (19b)
GTGCCCTGCCCCCATCTGG
>Probe|12380402|PRIMERR Reverse PCR primer (outermost) (21b)
GGACCTGACTGAGAATCAAGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS6680

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149986
Probe Cross-refcontext specific help for: Probe Cross-refGDB:370879
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center