Display Settings:

Format

Send to:

Choose Destination
Pr012344931

STS probe D17S1184 for LSM12 homolog (LSM12) and 1 more gene

Synopsis

Field NameValues
NameD17S1184
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLSM12; LSM12
UniSTS IDUniSTS:149796

Sequences

>Probe|12344931|PRIMERF Forward PCR primer (outermost) (22b)
GAAAAGACAAGCCATAGACTGG
>Probe|12344931|PRIMERR Reverse PCR primer (outermost) (22b)
AGACAGTGTCCGTATTAAACAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S1184

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149796
Probe Cross-refcontext specific help for: Probe Cross-refGDB:344805
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center