Display Settings:

Format

Send to:

Choose Destination
Pr012344851

STS probe D22S622 for phospholipase A2 group VI (PLA2G6)

Synopsis

Field NameValues
NameD22S622
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePLA2G6
UniSTS IDUniSTS:149723

Sequences

>Probe|12344851|PRIMERF Forward PCR primer (outermost) (20b)
CTGTCCTGGGCTTTGAAACT
>Probe|12344851|PRIMERR Reverse PCR primer (outermost) (20b)
GACCTGCAAACCTCTTGAAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S622

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149723
Probe Cross-refcontext specific help for: Probe Cross-refGDB:335990
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center