Display Settings:

Format

Send to:

Choose Destination
Pr012344738

STS probe D1S1425

Synopsis

Field NameValues
NameD1S1425
AliasD1S1516
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:149621

Sequences

>Probe|12344738|PRIMERF Forward PCR primer (outermost) (22b)
CTGAGGTCAGGAGTTCAAGACC
>Probe|12344738|PRIMERR Reverse PCR primer (outermost) (20b)
ATCTCGGCTCACTGCAATCT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:330277
UniSTS IDcontext specific help for: UniSTS ID149621
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center