Display Settings:

Format

Send to:

Choose Destination
Pr012343838

STS probe D22S102 for colony stimulating factor 2 receptor beta common subunit (CSF2RB) and 1 more gene

Synopsis

Field NameValues
NameD22S102
AliasesD22S102*1; stD22S102
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCSF2RB; CSF2RB
UniSTS IDUniSTS:148800

Sequences

>Probe|12343838|PRIMERF Forward PCR primer (outermost) (21b)
ACATCACAGAGACAAAGGCTG
>Probe|12343838|PRIMERR Reverse PCR primer (outermost) (20b)
CCGTCCTTTCCTTTTATGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S102

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID148800
Probe Cross-refcontext specific help for: Probe Cross-refGDB:270291
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center