Display Settings:

Format

Send to:

Choose Destination
Pr012327465

STS probe D16S434E for G protein subunit alpha o1 (GNAO1) and 3 more genes

Synopsis

Field NameValues
NameD16S434E
TypeSTS
Application
Source organism
Source sequence
Target genesGNAO1; GNAO1; GNAO1; LOC735602
UniSTS IDUniSTS:147420

Sequences

>Probe|12327465|PRIMERF Forward PCR primer (outermost) (20b)
GACGGAGCCAAATCTCATTT
>Probe|12327465|PRIMERR Reverse PCR primer (outermost) (20b)
AAATTCTCTCCCTGTGCATG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188945
UniSTS IDcontext specific help for: UniSTS ID147420
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center