Display Settings:

Format

Send to:

Choose Destination
Pr012326825

STS probe D16S287

Synopsis

Field NameValues
NameD16S287
Alias16ACXE81
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:146844

Sequences

>Probe|12326825|PRIMERF Forward PCR primer (outermost) (25b)
GCTTGTATTAGTCAGCATTCTCCAG
>Probe|12326825|PRIMERR Reverse PCR primer (outermost) (23b)
TACAGACCATAGACTTGACAGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:180335
UniSTS IDcontext specific help for: UniSTS ID146844
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center