Display Settings:

Format

Send to:

Choose Destination
Pr031783341

Homo sapiens STS probe UniSTS:146589

Synopsis

Field NameValues
NameUniSTS:146589
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:146589

Sequences

>Probe|31783341|PRIMERF Forward PCR primer (outermost) (21b)
TGTGAGGATGTGAGGTTTTCC
>Probe|31783341|PRIMERR Reverse PCR primer (outermost) (18b)
GGAACACCACAGCCCAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmUniSTS:146589

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID146589
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center