Display Settings:

Format

Send to:

Choose Destination
Pr012380134

STS probe stbK299D3A for hypothetical protein LOC643266 (LOC643266) and 1 more gene

Synopsis

Field NameValues
NamestbK299D3A
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100581010; LOC643266
UniSTS IDUniSTS:146588

Sequences

>Probe|12380134|PRIMERF Forward PCR primer (outermost) (20b)
GGTTGCCCTCCCAATAATTT
>Probe|12380134|PRIMERR Reverse PCR primer (outermost) (18b)
GTCACCACAGCCCCTGTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmstbK299D3A

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID146588
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center