Display Settings:

Format

Send to:

Choose Destination
Pr012378028

STS probe Trrp2 for transient receptor potential cation channel, subfamily C, member 2 (Trpc2) and 2 more genes

Synopsis

Field NameValues
NameTrrp2
AliasTrpc2
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100009370; Trpc2; Trpc2
UniSTS IDUniSTS:144683

Sequences

>Probe|12378028|PRIMERF Forward PCR primer (outermost) (21b)
TGGACATGCCTCAGTTCCTGG
>Probe|12378028|PRIMERR Reverse PCR primer (outermost) (21b)
TTTCCACTCCACATCAGCATC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1277863
UniSTS IDcontext specific help for: UniSTS ID144683
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center