Display Settings:

Format

Send to:

Choose Destination
Pr012377686

STS probe Scn11a for sodium channel, voltage-gated, type XI, alpha (Scn11a)

Synopsis

Field NameValues
NameScn11a
TypeSTS
Application
Source organism
Source sequence
Target geneScn11a
UniSTS IDUniSTS:144374

Sequences

>Probe|12377686|PRIMERF Forward PCR primer (outermost) (23b)
GGACTGCCAAGGACATCCACAGT
>Probe|12377686|PRIMERR Reverse PCR primer (outermost) (26b)
TGTCAAACACCTAGGACAGAGATCAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1345485
UniSTS IDcontext specific help for: UniSTS ID144374
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center