Display Settings:

Format

Send to:

Choose Destination
Pr012377627

STS probe Rag2 for recombination activating gene 2 (Rag2) and 3 more genes

Synopsis

Field NameValues
NameRag2
TypeSTS
Application
Source organism
Source sequence
Target genesRag2; RGD1309730; Rag2; B230118H07Rik
UniSTS IDUniSTS:144320

Sequences

>Probe|12377627|PRIMERF Forward PCR primer (outermost) (20b)
CCTGCAGATGGTAACAGTGG
>Probe|12377627|PRIMERR Reverse PCR primer (outermost) (19b)
TCTTGCAACGACAGACATG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center