Display Settings:

Format

Send to:

Choose Destination
Pr012376425

STS probe Gpcr12 for G-protein coupled receptor 3 (Gpr3) and 4 more genes

Synopsis

Field NameValues
NameGpcr12
AliasGpr12
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100046390; Gpr3; Gpr3; Gpr3; Cd164l2
UniSTS IDUniSTS:143237

Sequences

>Probe|12376425|PRIMERF Forward PCR primer (outermost) (18b)
TCCACGCCCTTAAGACCC
>Probe|12376425|PRIMERR Reverse PCR primer (outermost) (21b)
TCTGGGAAGGAAGATCAAGGA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center