Display Settings:

Format

Send to:

Choose Destination
Pr012376283

STS probe UniSTS:143109 for protein phosphatase, Mg2+/Mn2+ dependent 1G (PPM1G) and 30 more genes

Synopsis

Field NameValues
NameUniSTS:143109
AliasPpm1g
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPPM1G; ZNF513; ZNF513; PPM1G; ZNF513; ZNF513; PPM1G; PPM1G; ZNF513; PPM1G; ZNF513; PPM1G; ZNF513; Znf513More
UniSTS IDUniSTS:143109

Sequences

>Probe|12376283|PRIMERF Forward PCR primer (outermost) (20b)
GTGCCTGTGCTCTGTTGTGT
>Probe|12376283|PRIMERR Reverse PCR primer (outermost) (18b)
ACAACAGAGAGCGGGTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmUniSTS:143109

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center