Display Settings:

Format

Send to:

Choose Destination
Pr012375940

STS probe SHGC-16536 for solute carrier family 38 member 6 (SLC38A6) and 3 more genes

Synopsis

Field NameValues
NameSHGC-16536
AliasRH14274
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC38A6; SLC38A6; SLC38A6; SLC38A6
UniSTS IDUniSTS:14280

Sequences

>Probe|12375940|PRIMERF Forward PCR primer (outermost) (19b)
AGCTTGGGGCATCAAAGAC
>Probe|12375940|PRIMERR Reverse PCR primer (outermost) (22b)
CCTTTGCCTAATTTAACATGGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3142010 cr10000SHGC-16536
Homo sapiensradiation hybridGeneMap99-G3142058 cr10000SHGC-16536
Homo sapienslinkageRutgers Map14 cmSHGC-16536

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14280
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center