Display Settings:

Format

Send to:

Choose Destination
Pr012374509

STS probe D7S714 for heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1) and 6 more genes

Synopsis

Field NameValues
NameD7S714
AliasesRH32043; SHGC-3002; SWSS167
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHNRNPA2B1; HNRNPA2B1; HNRNPA2B1; HNRNPA2B1; HNRNPA2B1; HNRNPA2B1; HNRNPA2B1
UniSTS IDUniSTS:14151

Sequences

>Probe|12374509|PRIMERF Forward PCR primer (outermost) (18b)
AGCTTACAGACTGTGTGG
>Probe|12374509|PRIMERR Reverse PCR primer (outermost) (22b)
ATCCCTCATTACCTTTCAAACC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G371111 cr10000SHGC-3002
Homo sapienslinkageRutgers Map7 cmD7S714

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14151
Probe Cross-refcontext specific help for: Probe Cross-refGDB:204785
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center