Display Settings:

Format

Send to:

Choose Destination
Pr012374305

STS probe Cfl1 for cofilin 1, non-muscle (Cfl1) and 7 more genes

Synopsis

Field NameValues
NameCfl1
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100048522; Cfl1; Cfl1; Rbm6; Gm6180; LOC684817; LOC688430; CFL1
UniSTS IDUniSTS:141326

Sequences

>Probe|12374305|PRIMERF Forward PCR primer (outermost) (24b)
CAACCTATGAGAGCAAGGAGAGCA
>Probe|12374305|PRIMERR Reverse PCR primer (outermost) (24b)
CTTGACCTTCCTCGTAGCAGTTAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center