Display Settings:

Format

Send to:

Choose Destination
Pr012374302

STS probe Cer1 for cerberus 1, DAN family BMP antagonist (Cer1)

Synopsis

Field NameValues
NameCer1
TypeSTS
Application
Source organism
Source sequence
Target geneCer1
UniSTS IDUniSTS:141323

Sequences

>Probe|12374302|PRIMERF Forward PCR primer (outermost) (22b)
CTCAACAGAAAGCAAAACCTCA
>Probe|12374302|PRIMERR Reverse PCR primer (outermost) (20b)
TGAGGCCAGCTGAGAATACA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1345244
UniSTS IDcontext specific help for: UniSTS ID141323
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center