Display Settings:

Format

Send to:

Choose Destination
Pr012374088

STS probe AL031562 for kelch like family member 13 (KLHL13)

Synopsis

Field NameValues
NameAL031562
AliasstSG14861
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneKLHL13
UniSTS IDUniSTS:14113

Sequences

>Probe|12374088|PRIMERF Forward PCR primer (outermost) (22b)
AGCTGTGGGTCTGACATAAACA
>Probe|12374088|PRIMERR Reverse PCR primer (outermost) (18b)
CCAGGGATGCAAGGATGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL031562

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14113
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center