Display Settings:

Format

Send to:

Choose Destination
Pr012374019

STS probe Alas2 for aminolevulinic acid synthase 2, erythroid (Alas2) and 2 more genes

Synopsis

Field NameValues
NameAlas2
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100363476; Alas2; Alas2
UniSTS IDUniSTS:141068

Sequences

>Probe|12374019|PRIMERF Forward PCR primer (outermost) (18b)
GTGTCTGTGGCTGCATGC
>Probe|12374019|PRIMERR Reverse PCR primer (outermost) (21b)
AGCTGGCTCCTTAAGCATAGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center