Display Settings:

Format

Send to:

Choose Destination
Pr012373777

STS probe D2S2228 for adaptor related protein complex 1 sigma 3 subunit (AP1S3) and 1 more gene

Synopsis

Field NameValues
NameD2S2228
AliasesAFMa337zd1; HSA337ZD1; RH30784; RH9747; SHGC-20068
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesAP1S3; AP1S3
UniSTS IDUniSTS:14085

Sequences

>Probe|12373777|PRIMERF Forward PCR primer (outermost) (19b)
AGCTGTAAGGAAGCAGCAC
>Probe|12373777|PRIMERR Reverse PCR primer (outermost) (20b)
AAAAGGACTTATTCTGGGGA

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G329567 cr10000AFMa337zd1
Homo sapienslinkageRutgers Map2 cmD2S2228
Homo sapienslinkageMarshfield2224.33 cmAFMa337zd1
Homo sapienslinkagedeCODE2227.17 cmD2S2228
Homo sapienslinkageGenethon2231.8 cmAFMa337zd1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14085
Probe Cross-refcontext specific help for: Probe Cross-refGDB:602444; GDB:608754
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center