Display Settings:

Format

Send to:

Choose Destination
Pr012372543

STS probe D22S257 for BCR, RhoGEF and GTPase activating protein (BCR) and 3 more genes

Synopsis

Field NameValues
NameD22S257
AliasHUMPOLYZZZ
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100288030; BCR; BCR; BCR
UniSTS IDUniSTS:13974

Sequences

>Probe|12372543|PRIMERF Forward PCR primer (outermost) (20b)
AGCTGATACACCACTTCTGA
>Probe|12372543|PRIMERR Reverse PCR primer (outermost) (20b)
GTCAGAAATATCCTTCCCAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13974
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center