Display Settings:

Format

Send to:

Choose Destination
Pr012371970

STS probe G62079 for beta-2-microglobulin (B2M) and 2 more genes

Synopsis

Field NameValues
NameG62079
Alias930
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesB2M; B2M; B2M
UniSTS IDUniSTS:139221

Sequences

>Probe|12371970|PRIMERF Forward PCR primer (outermost) (20b)
ATCTGAGCAGGTTGCTCCAC
>Probe|12371970|PRIMERR Reverse PCR primer (outermost) (22b)
GCTTTGAGTGCAAGAGATTGAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmG62079

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID139221
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center