Display Settings:

Format

Send to:

Choose Destination
Pr012371947

STS probe G62075 for KRAS proto-oncogene, GTPase pseudogene 1 (KRASP1) and 4 more genes

Synopsis

Field NameValues
NameG62075
Alias2019
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100128671; KRAS; KRAS; KRASP1; KRAS
UniSTS IDUniSTS:139200

Sequences

>Probe|12371947|PRIMERF Forward PCR primer (outermost) (26b)
TGCTATCCAGTATTAACACAGAAGTT
>Probe|12371947|PRIMERR Reverse PCR primer (outermost) (25b)
CAGCAAAAACTATCTGAAGATTTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID139200
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center