Display Settings:

Format

Send to:

Choose Destination
Pr012371757

STS probe D5S1989 for F-box and leucine rich repeat protein 7 (FBXL7) and 8 more genes

Synopsis

Field NameValues
NameD5S1989
AliasesA247WC1; AFMA247WC1; AFMa247wc1; HSA247WC1; W5864
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100287480; LOC100289988; LOC100292610; FBXL7; FBXL7; FBXL7; FBXL7; FBXL7; FBXL7
UniSTS IDUniSTS:13903

Sequences

>Probe|12371757|PRIMERF Forward PCR primer (outermost) (20b)
AGCTCTGGACATCTCGATTA
>Probe|12371757|PRIMERR Reverse PCR primer (outermost) (21b)
GGGAATTATCTTCCAAAATGC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S1989
Homo sapienslinkageMarshfield528.22 cmAFMa247wc1
Homo sapienslinkagedeCODE534.8 cmD5S1989
Homo sapienslinkageGenethon527.3 cmAFMa247wc1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13903
Probe Cross-refcontext specific help for: Probe Cross-refGDB:608061
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center