Display Settings:

Format

Send to:

Choose Destination
Pr012371569

STS probe RH118881 for usherin (USH2A) and 4 more genes

Synopsis

Field NameValues
NameRH118881
AliasSHGC-89170
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUSH2A; USH2A; USH2A; USH2A; USH2A
UniSTS IDUniSTS:138861

Sequences

>Probe|12371569|PRIMERF Forward PCR primer (outermost) (23b)
GCATCTCCATTTTTCTCATTTGG
>Probe|12371569|PRIMERR Reverse PCR primer (outermost) (23b)
TGTTCTTCATTATGCACCCATCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmRH118881

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID138861
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center