Display Settings:

Format

Send to:

Choose Destination
Pr012370712

Homo sapiens STS probe D4S3025

Synopsis

Field NameValues
NameD4S3025
AliasesA047YF1; AFMA047YF1; AFMa047yf1; HSA047YF1; W5031
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:13809

Sequences

>Probe|12370712|PRIMERF Forward PCR primer (outermost) (18b)
AGCTCANAGTGTCCACAA
>Probe|12370712|PRIMERR Reverse PCR primer (outermost) (24b)
ATTGGGTTAAGATTTAATGAAACA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmD4S3025
Homo sapienslinkageMarshfield460.16 cmAFMa047yf1
Homo sapienslinkagedeCODE464.27 cmD4S3025
Homo sapienslinkageGenethon461 cmAFMa047yf1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13809
Probe Cross-refcontext specific help for: Probe Cross-refGDB:613551
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center