Display Settings:

Format

Send to:

Choose Destination
Pr012369919

STS probe G60271 for imprinted in Prader-Willi syndrome (non-protein coding) (IPW) and 2 more genes

Synopsis

Field NameValues
NameG60271
AliasSHGC-130970
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100584218; IPW; SNRPN
UniSTS IDUniSTS:137376

Sequences

>Probe|12369919|PRIMERF Forward PCR primer (outermost) (23b)
TTCAATGGCCTTTTTCTTTTTCA
>Probe|12369919|PRIMERR Reverse PCR primer (outermost) (23b)
CAATCTCATTCATTGCCATTTGA

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG151754 cr50000SHGC-130970
Homo sapienslinkageRutgers Map15 cmG60271

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID137376
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center