Display Settings:

Format

Send to:

Choose Destination
Pr012368779

Homo sapiens STS probe D4S2912

Synopsis

Field NameValues
NameD4S2912
AliasesA126XA9; AFMA126XA9; AFMa126xa9; HSA126XA9; W5448
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:13635

Sequences

>Probe|12368779|PRIMERF Forward PCR primer (outermost) (19b)
AGCTAAACCATTATGGCAT
>Probe|12368779|PRIMERR Reverse PCR primer (outermost) (22b)
TCTAGTTAATTCTCCGTTTCAT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmD4S2912
Homo sapienslinkageMarshfield447.58 cmAFMa126xa9
Homo sapienslinkageGenethon446.9 cmAFMa126xa9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13635
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603290
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center