Display Settings:

Format

Send to:

Choose Destination
Pr012367690

STS probe SHGC-9194 for glyceraldehyde 3 phosphate dehydrogenase pseudogene 34 (GAPDHP34) and 1 more gene

Synopsis

Field NameValues
NameSHGC-9194
AliasRH35323
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGAPDHP34; LOC651873
UniSTS IDUniSTS:13537

Sequences

>Probe|12367690|PRIMERF Forward PCR primer (outermost) (20b)
AGCCTTTGAGTTTGAAGGCA
>Probe|12367690|PRIMERR Reverse PCR primer (outermost) (25b)
ACACTGTTTTAGTCGTTTTCCTACG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G313756 cr10000SHGC-9194
Homo sapienslinkageRutgers Map13 cmSHGC-9194
Homo sapiensradiation hybridNCBI RH13311.2 crSHGC-9194

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13537
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center