Display Settings:

Format

Send to:

Choose Destination
Pr012364829

STS probe RH120714 for erythrocyte membrane protein band 4.1 like 1 (EPB41L1) and 4 more genes

Synopsis

Field NameValues
NameRH120714
AliasSHGC-100732
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEPB41L1; EPB41L1; EPB41L1; EPB41L1; EPB41L1
UniSTS IDUniSTS:132795

Sequences

>Probe|12364829|PRIMERF Forward PCR primer (outermost) (23b)
GCATATTGGTGTGGAGGATGAGT
>Probe|12364829|PRIMERR Reverse PCR primer (outermost) (23b)
TGAGAAAGCCAATGAGGTAGGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmRH120714

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID132795
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center