Display Settings:

Format

Send to:

Choose Destination
Pr012364189

STS probe RH119813 for sarcoglycan delta (SGCD) and 1 more gene

Synopsis

Field NameValues
NameRH119813
AliasesG-101311; SHGC-101311
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSGCD; SGCD
UniSTS IDUniSTS:132217

Sequences

>Probe|12364189|PRIMERF Forward PCR primer (outermost) (23b)
CAAGTCCCAAAGAGGCAAGACTA
>Probe|12364189|PRIMERR Reverse PCR primer (outermost) (23b)
GCATTGGAATTTGAACTCAGGAA

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG573758 cr50000SHGC-101311
Homo sapienslinkageRutgers Map5 cmRH119813

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID132217
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center