Display Settings:

Format

Send to:

Choose Destination
Pr012363841

Mus musculus STS probe D9Mit34.1

Synopsis

Field NameValues
NameD9Mit34.1
AliasD9Mit34
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
UniSTS IDUniSTS:131903

Sequences

>Probe|12363841|PRIMERF Forward PCR primer (outermost) (21b)
TGAGATGGCTCAGTGGGTAAG
>Probe|12363841|PRIMERR Reverse PCR primer (outermost) (25b)
ACACTGTAGCTGTCTTCAGACACTC

References

1.

A genetic map of the mouse with 4,006 simple sequence length polymorphisms.

Dietrich WF, Miller JC, Steen RG, Merchant M, Damron D, Nahf R, Gross A, Joyce DC, Wessel M, Dredge RD, et al.

Nat Genet. 1994 Jun;7(2 Spec No):220-45.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculuslinkageWI_GEN943.7 cmD9Mit34.1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:706037
UniSTS IDcontext specific help for: UniSTS ID131903
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center