Display Settings:

Format

Send to:

Choose Destination
Pr012362729

STS probe D6Mit351 for enhancer of zeste 2 polycomb repressive complex 2 subunit (Ezh2)

Synopsis

Field NameValues
NameD6Mit351
AliasMTH2823
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneEzh2
UniSTS IDUniSTS:130902

Sequences

>Probe|12362729|PRIMERF Forward PCR primer (outermost) (26b)
AAGGTTTTTATTTTCAATTCTCTGTG
>Probe|12362729|PRIMERR Reverse PCR primer (outermost) (23b)
CTATCTGATGACCTCTTGTTGCC

References

1.

A genetic map of the mouse with 4,006 simple sequence length polymorphisms.

Dietrich WF, Miller JC, Steen RG, Merchant M, Damron D, Nahf R, Gross A, Joyce DC, Wessel M, Dredge RD, et al.

Nat Genet. 1994 Jun;7(2 Spec No):220-45.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculuslinkageWI_GEN610.9 cmD6Mit351

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:707021
UniSTS IDcontext specific help for: UniSTS ID130902
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center