Display Settings:

Format

Send to:

Choose Destination
Pr012362226

STS probe D1S3250 for S100 calcium binding protein A10 (S100A10) and 1 more gene

Synopsis

Field NameValues
NameD1S3250
AliasesD1S3606; RH63791; RH8729; SHGC-9853; STSG-9853; UTR-9853; stSG13910
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesS100A10; S100A10
UniSTS IDUniSTS:13045

Sequences

>Probe|12362226|PRIMERF Forward PCR primer (outermost) (18b)
AGCAGTTCGCTCCTCCCT
>Probe|12362226|PRIMERR Reverse PCR primer (outermost) (23b)
CTGCTCATGAAATCCTTCTATGG

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G311705 cr10000SHGC-9853
Homo sapiensradiation hybridGeneMap99-GB41545.37 cr3000UTR-9853
Homo sapienslinkageRutgers Map1 cmD1S3250

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID13045
Probe Cross-refcontext specific help for: Probe Cross-refGDB:674987; GDB:675615
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center