Display Settings:

Format

Send to:

Choose Destination
Pr012357031

STS probe X01023 for myelocytomatosis oncogene (Myc)

Synopsis

Field NameValues
NameX01023
TypeSTS
Application
Source organism
Source sequence
Target geneMyc
UniSTS IDUniSTS:125775

Sequences

>Probe|12357031|PRIMERF Forward PCR primer (outermost) (20b)
GCCTAACCTCACAACCTTGG
>Probe|12357031|PRIMERR Reverse PCR primer (outermost) (23b)
CCTATTTACATGGGAAAATTGGA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID125775
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center