Display Settings:

Format

Send to:

Choose Destination
Pr012356963

STS probe U29086 for neurogenic differentiation 6 (Neurod6)

Synopsis

Field NameValues
NameU29086
TypeSTS
Application
Source organism
Source sequence
Target geneNeurod6
UniSTS IDUniSTS:125713

Sequences

>Probe|12356963|PRIMERF Forward PCR primer (outermost) (21b)
CCTTTCCTTCCCTCTTGTCTG
>Probe|12356963|PRIMERR Reverse PCR primer (outermost) (23b)
TCAGCAACATCTTAGACACCTTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID125713
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center