Display Settings:

Format

Send to:

Choose Destination
Pr012356725

STS probe D4S2482E for SLAIN motif family member 2 (SLAIN2) and 2 more genes

Synopsis

Field NameValues
NameD4S2482E
AliasesBDAA1H06; RH73572; RH8539; SHGC-8553
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLAIN2; SLAIN2; SLAIN2
UniSTS IDUniSTS:1255

Sequences

>Probe|12356725|PRIMERF Forward PCR primer (outermost) (21b)
AAAGACCTTCTACCCTTCCAC
>Probe|12356725|PRIMERR Reverse PCR primer (outermost) (22b)
GTTGTCTGCAATCCCATAATCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G342969 cr10000SHGC-8553
Homo sapiensradiation hybridGeneMap99-G342953 cr10000SHGC-8553
Homo sapienslinkageRutgers Map4 cmD4S2482E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID1255
Probe Cross-refcontext specific help for: Probe Cross-refGDB:442329
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center