Display Settings:

Format

Send to:

Choose Destination
Pr012355249

STS probe D19S906 for zinc finger protein 440 (ZNF440) and 1 more gene

Synopsis

Field NameValues
NameD19S906
AliasesAFMB055ZC9; AFMb055zc9; B055ZC9; HSB055ZC9; W6304
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesZNF440; ZNF440
UniSTS IDUniSTS:12417

Sequences

>Probe|12355249|PRIMERF Forward PCR primer (outermost) (20b)
AGATCGCACCACTGTACTCC
>Probe|12355249|PRIMERR Reverse PCR primer (outermost) (19b)
TTCCCGCCTAGTAACGGAC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map19 cmD19S906
Homo sapienslinkageMarshfield1936.22 cmAFMb055zc9
Homo sapienslinkagedeCODE1932.22 cmD19S906
Homo sapienslinkageGenethon1935.3 cmAFMb055zc9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12417
Probe Cross-refcontext specific help for: Probe Cross-refGDB:609792
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center