Display Settings:

Format

Send to:

Choose Destination
Pr012353243

STS probe D11S4345 for uncharacterized LOC100506082 (LOC100506082)

Synopsis

Field NameValues
NameD11S4345
AliasesRH1984; SHGC-14668
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100506082
UniSTS IDUniSTS:12222

Sequences

>Probe|12353243|PRIMERF Forward PCR primer (outermost) (25b)
AGAGGGTATCAAAGTGTGATAATGG
>Probe|12353243|PRIMERR Reverse PCR primer (outermost) (22b)
GGAGCTCCTAATCTGAGAGCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G311125 cr10000SHGC-14668
Homo sapiensradiation hybridGeneMap99-G311125 cr10000SHGC-14668
Homo sapienslinkageRutgers Map11 cmD11S4345
Homo sapiensradiation hybridNCBI RH1114.1 crSHGC-14668

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID12222
Probe Cross-refcontext specific help for: Probe Cross-refGDB:675874; GDB:676728
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center