Display Settings:

Format

Send to:

Choose Destination
Pr012350279

STS probe D3Rat55 for similar to PR domain containing 12 (LOC687700) and 1 more gene

Synopsis

Field NameValues
NameD3Rat55
AliasesR0011-B06; RH87285
TypeSTS
Application
Source organism
Source sequence
Target organismRattus norvegicus
Target genesLOC687700; Prdm12
UniSTS IDUniSTS:118781

Sequences

>Probe|12350279|PRIMERF Forward PCR primer (outermost) (20b)
CCACGTTCACACACACCTTG
>Probe|12350279|PRIMERR Reverse PCR primer (outermost) (20b)
CAATTATTTCCTTGGCAGGC

References

1.

High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.

Kwitek AE, Gullings-Handley J, Yu J, Carlos DC, Orlebeke K, Nie J, Eckert J, Lemke A, Andrae JW, Bromberg S, Pasko D, Chen D, Scheetz TE, Casavant TL, Soares MB, Sheffield VC, Tonellato PJ, Jacob HJ.

Genome Res. 2004 Apr;14(4):750-7.

2.

A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat.

Steen RG, Kwitek-Black AE, Glenn C, Gullings-Handley J, Van Etten W, Atkinson OS, Appel D, Twigger S, Muir M, Mull T, Granados M, Kissebah M, Russo K, Crane R, Popp M, Peden M, Matise T, Brown DM, Lu J, Kingsmore S, Tonellato PJ, Rozen S, Slonim D, Young P, Jacob HJ.

Genome Res. 1999 Jun;9(6):AP1-8, insert. Genome Res 1999 Aug;9(8):793.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Rattus norvegicusradiation hybridMCW RH359.5 crD3Rat55

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:35054
UniSTS IDcontext specific help for: UniSTS ID118781
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center