Display Settings:

Format

Send to:

Choose Destination
Pr012349212

STS probe G54719 for FRAS1 related extracellular matrix 1 (FREM1) and 2 more genes

Synopsis

Field NameValues
NameG54719
AliasAffySTS000136
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFREM1; FREM1; FREM1
UniSTS IDUniSTS:117820

Sequences

>Probe|12349212|PRIMERF Forward PCR primer (outermost) (20b)
TCCTTTCAGCATTTCCTTCC
>Probe|12349212|PRIMERR Reverse PCR primer (outermost) (20b)
ACACAATGGGGAATCTGCAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmG54719

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID117820
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center