Display Settings:

Format

Send to:

Choose Destination
Pr012349055

Homo sapiens STS probe D17S974

Synopsis

Field NameValues
NameD17S974
AliasesCHLC.424; CHLC.GATA8C04; CHLC.GATA8C04.424; CHLC.GATA8C04.P6436; GATA-D17S974; GATA8C04; RH28218; RH54954
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:11768

Sequences

>Probe|12349055|PRIMERF Forward PCR primer (outermost) (22b)
AGACCCTGTCTCAGATAGATGG
>Probe|12349055|PRIMERR Reverse PCR primer (outermost) (21b)
TAAAATAGAAAGTGCCCCTCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S974
Homo sapienslinkageMarshfield1722.24 cmGATA8C04
Homo sapiensradiation hybridNCBI RH17279 crCHLC.GATA8C04.424
Homo sapiensradiation hybridWhitehead-RH17108.6 cr3000CHLC.GATA8C04.424

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID11768
Probe Cross-refcontext specific help for: Probe Cross-refGDB:228649; GDB:686880
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center