Display Settings:

Format

Send to:

Choose Destination
Pr012348619

STS probe G32705 for KIAA1671 (KIAA1671) and 4 more genes

Synopsis

Field NameValues
NameG32705
AliasA009O20
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100426035; LOC100452832; KIAA1671; KIAA1671; KIAA1671
UniSTS IDUniSTS:117287

Sequences

>Probe|12348619|PRIMERF Forward PCR primer (outermost) (21b)
GACATTCTGTGGTCTCTGAAT
>Probe|12348619|PRIMERR Reverse PCR primer (outermost) (18b)
GCCTACCAGCTTTTTACG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmG32705

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID117287
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center