Display Settings:

Format

Send to:

Choose Destination
Pr012348195

STS probe G32311 for inka box actin regulator 2 (INKA2) and 1 more gene

Synopsis

Field NameValues
NameG32311
AliasA005Z45
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesINKA2; INKA2
UniSTS IDUniSTS:116905

Sequences

>Probe|12348195|PRIMERF Forward PCR primer (outermost) (22b)
CATCCTAGTAATCGTACTAAGG
>Probe|12348195|PRIMERR Reverse PCR primer (outermost) (18b)
AAACTAATGGCCTAAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmG32311

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID116905
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center