Display Settings:

Format

Send to:

Choose Destination
Pr012347807

STS probe D13Mit148 for phosphodiesterase 4D, cAMP specific (Pde4d)

Synopsis

Field NameValues
NameD13Mit148
AliasesMTH180; ND; RH117606; RH74751
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genePde4d
UniSTS IDUniSTS:116556

Sequences

>Probe|12347807|PRIMERF Forward PCR primer (outermost) (20b)
TGCTTGTGCTCATGCATACA
>Probe|12347807|PRIMERR Reverse PCR primer (outermost) (23b)
AAAGGAAGGTGGCAAGTAATAGG

References

1.

A genetic map of the mouse with 4,006 simple sequence length polymorphisms.

Dietrich WF, Miller JC, Steen RG, Merchant M, Damron D, Nahf R, Gross A, Joyce DC, Wessel M, Dredge RD, et al.

Nat Genet. 1994 Jun;7(2 Spec No):220-45.

2.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculuslinkageWI_GEN1340.4 cmD13Mit148
Mus musculusradiation hybridWI/MRC-RH13942.98 crD13Mit148

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:707592
UniSTS IDcontext specific help for: UniSTS ID116556
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center