Display Settings:

Format

Send to:

Choose Destination
Pr012345927

Homo sapiens STS probe SHGC-3192

Synopsis

Field NameValues
NameSHGC-3192
AliasRH32282
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:11486

Sequences

>Probe|12345927|PRIMERF Forward PCR primer (outermost) (25b)
AGAATAAGTAGCAGAACAGAATTCC
>Probe|12345927|PRIMERR Reverse PCR primer (outermost) (27b)
GATTTATGTAACTTCATAACGTCTACC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3103286 cr10000SHGC-3192
Homo sapienslinkageRutgers Map10 cmSHGC-3192

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID11486
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center