Display Settings:

Format

Send to:

Choose Destination
Pr012333584

STS probe UniSTS:105160 for glucagon (GCG) and 15 more genes

Synopsis

Field NameValues
NameUniSTS:105160
AliasesGCG; Gcg
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGCG; Gcg; LOC100335208; GCG; GCG; GCG; GCG; Gcg; Gcg; GCG; GCG; GCG; GCG; FAPMore
UniSTS IDUniSTS:105160

Sequences

>Probe|12333584|PRIMERF Forward PCR primer (outermost) (19b)
GCCAAACGTCATGATGAAT
>Probe|12333584|PRIMERR Reverse PCR primer (outermost) (20b)
TCGCCTTCCTCGGCCTTTCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmUniSTS:105160

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center